A1 & CE

05.08.2016 - 8-Kanal-Pipetten, justierbar (2,0 - 500 μL). ▫ 96-Well-PCR-Platten passend zum ..... ExoSAP-IT PCR-Reinigung. Anzahl der Zyklen. Temperatur.
3MB Größe 11 Downloads 277 Ansichten
HOLOTYPE HLA 24/7 KONFIGURATION A1 & CE GEBRAUCHSANWEISUNG VERSION 8 05.08.2016 TM

Zur Anwendung in der In vitro-Diagnostik

0086

Vorbereitung der DNA zur Sequenzanalyse mittels Illumina MiSeq





Inhaltsverzeichnis HERSTELLERINFORMATIONEN ............................................................................................................................................. 7 SYMBOLSCHLÜSSEL ............................................................................................................................................................. 7 INHALT DES HOLOTYPE HLA-24/7 KONFIGURATION A1 & CE KITS ........................................................................................ 8 PRIMER COMPONENT BOX (PRIMER KOMPONENTEN BOX) ..................................................................................................................................................... 8 LIBRARY PREPARATION REAGENTS COMPONENT BOX ............................................................................................................................................................. 8 96- WELL ADAPTER PLATTE ................................................................................................................................................................................................ 8 EXCEL WORKBOOK .................................................................................................................................................................................................................... 9 SOFTWARE – OMIXON HLA TWIN .............................................................................................................................................................................................. 9

TRANSPORT UND LAGERUNG .............................................................................................................................................. 9 WARNHINWEISE UND VORSICHTSMASSNAHMEN ............................................................................................................... 9 SICHERHEITSINFORMATIONEN .......................................................................................................................................... 10 LEISTUNGSPARAMETER ..................................................................................................................................................... 10 TECHNISCHE BETREUUNG .................................................................................................................................................. 10 TELEFONISCHE BETREUUNG: ............................................................................................................................................. 10 EQUIPMENT, REAGENZIEN UND ZUBEHÖR ........................................................................................................................ 11 TECHNISCHE UND GERÄTEEMPFEHLUNG ................................................................................................................................................................................ 11 ZUGEHÖRIGE REAGENZEMPFEHLUNGEN ................................................................................................................................................................................ 11

MISEQ REAGENT KIT KAPAZITÄT ....................................................................................................................................... 11

EMPFOHLENES ZUBEHÖR ........................................................................................................................................................................................................ 11

IMPRESSUM ...................................................................................................................................................................... 12 VERWENDUNGSZWECK ..................................................................................................................................................... 12 WICHTIGE HINWEISE VOR BEGINN ..................................................................................................................................... 13 EMPFOHLENE GENOMISCHE DNA ISOLIERUNG ...................................................................................................................................................................... 13

PRINZIP DER METHODE ..................................................................................................................................................... 13 ZUSAMMENFASSUNG DER SCHRITTE ................................................................................................................................. 15 GLOSSAR/DEFINITIONEN ................................................................................................................................................... 16 SCHRITT 1 – HLA AMPLIFIKATION MASTER MIX VORBEREITUNG ....................................................................................... 17 LISTE DER REAGENZIEN ............................................................................................................................................................................................................ 17 PROTOKOLL .............................................................................................................................................................................................................................. 17

MASTER MIX: HLA-DQB1 SET 1 (OPTIONAL) AND DQB1 SET 2 (EMPFOHLEN) .................................................................. 18

SCHRITT 2 – HLA KLASSE I UND II AMPLIFIKATION ............................................................................................................. 19 LISTE DER REAGENZIEN ............................................................................................................................................................................................................ 19 PROTOKOLL .............................................................................................................................................................................................................................. 19

ENZYM BELADENER MASTER MIX: HLA-A, B, C, DRB1, DPB1 UND DQA1 .......................................................................... 19 ENZYM BELADENER MASTER MIX: HLA-DQB1 SET 1 (OPTIONAL) UND HLA-DQB1 SET 2 (EMPFOHLEN) .......................... 19 AMPLIFIKATION DER KLASSE I (HLA-A, B UND C) ............................................................................................................... 20 AMPLIFIKATION DER KLASSE II (HLA-DRB1, DQB1 SET 1, DQB1 SET 2, DPB1 UND DQA1) ................................................ 20 GESCHÄTZTE AMPLIFIKATSGRÖSSEN ................................................................................................................................. 20

SCHRITT 3 - AMPLIFIKATSBEWERTUNG UND -NORMALISIERUNG (MITTELS PLATTEN-FLUOROMETER) ............................... 22 LISTE DER REAGENZIEN ............................................................................................................................................................................................................ 22 PROTOKOLL .............................................................................................................................................................................................................................. 22

EXOSAP-IT PCR-REINIGUNG ............................................................................................................................................... 24

SCHRITT 4 – LIBRARY VORBEREITUNG ................................................................................................................................ 25 LISTE DER REAGENZIEN ............................................................................................................................................................................................................ 25 PROTOKOLL .............................................................................................................................................................................................................................. 25

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 2 │ 45



FRAGMENTATION MASTER MIX ........................................................................................................................................ 25 FRAGMENTIERUNGSPROGRAMM ..................................................................................................................................... 26 END REPAIR MASTER MIX .................................................................................................................................................. 27 END REPAIR PROGRAMM .................................................................................................................................................. 27 LIGATION MASTER MIX ...................................................................................................................................................... 28 LIGATIONSPROGRAMM ..................................................................................................................................................... 28 SCHRITT 5 – LIBRARY-GRÖSSENAUSWAHL ......................................................................................................................... 31 LISTE DER REAGENZIEN ............................................................................................................................................................................................................ 31 PROTOKOLL .............................................................................................................................................................................................................................. 31

SCHRITT 6 –LIBRARY BEWERTUNG ..................................................................................................................................... 32 LISTE DER REAGENZIEN ............................................................................................................................................................................................................ 32 PROTOKOLL .............................................................................................................................................................................................................................. 32

QPCR PRIMER MIX ............................................................................................................................................................. 32 QPCR MASTER MIX ............................................................................................................................................................ 33

SCHRITT 7 –SEQUENZIERUNG AM ILLUMINA MISEQ .......................................................................................................... 34 LISTE DER REAGENZIEN ............................................................................................................................................................................................................ 34

MISEQ REAGENT KIT KAPAZITÄT ....................................................................................................................................... 34

PROTOKOLL .............................................................................................................................................................................................................................. 34

SCHRITT 8 – ANALYSE DER HLA SEQUENZDATEN ................................................................................................................ 36 AUTOMATISCHES PROTOKOLL ................................................................................................................................................................................................ 36

IT SETUP UND KONFIGURATION ........................................................................................................................................ 36 PROTOKOLL PER ANALYSE ................................................................................................................................................. 36

MANUELLES SERVER PROTOKOLL ............................................................................................................................................................................................ 36

IT SETUP UND KONFIGURATION ........................................................................................................................................ 36 PROTOKOLL PER ANALYSE ................................................................................................................................................. 36

MANUELLES DESKTOP PROTOKOLL ......................................................................................................................................................................................... 36

IT SETUP UND KONFIGURATION ........................................................................................................................................ 36 PROTOKOLL PER ANALYSE ................................................................................................................................................. 37

ERGÄNZENDE ABBILDUNGEN ............................................................................................................................................ 38 PLATTENBEISPIELE FÜR EINE AMPLIFIKATE-PLATTE, AMPLIFIKATIONSPLATTE, VERDÜNNUNGSPLATTE, AMPLIFIKATE-BEWERTUNGSPLATTE (FÜR EINEN INDIVIDUELLEN ORT) & REAKTIONSPLATTE ............................................................................................................................................................................ 38 BEISPIEL EINER STANDARD-BERWERTUNGSPLATTE ................................................................................................................................................................ 39 QPCR-PLATTENBEISPIEL ........................................................................................................................................................................................................... 39

ANHANG 1: PIPPIN PREP .................................................................................................................................................... 40 PROGRAMMIERUNG VON PIPPIN PREP ................................................................................................................................................................................... 40 LAUF DER PIPPIN PREP ............................................................................................................................................................................................................ 40

ANHANG 2: PROBENBLATT ................................................................................................................................................ 43 ANHANG 3: AMPLIFIKAT BEWERTUNG MITTELS EINES QPCR-GERÄTS ............................................................................ 44



LISTE DER REAGENZIEN ............................................................................................................................................................................................................ 44 PROTOKOLL .............................................................................................................................................................................................................................. 44

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 3 │ 45



Dokumentenhistorie –Wichtige Anmerkungen und Updates

Version

Datum

Autor

Summe der Änderungen Autorisiert von



V1

5/12/2015 Robert Pollock Entwurf der ersten Version

Gergely Tölgyesi

V2

18/01/2016 Robert Pollock Zweiter Entwurf, geringfügige Korrekturen 10/02/2016 Robert Pollock Dritter Entwurf, aktualisierte Symbolerklärung, aktualisierte Gefrier/Tau Zyklusempfehlungen, aktualisierte zweckmä 26/02/2016 Robert Pollock Vierter Entwurf, ßige Anwendung Aktualisierung des Abschnitts "Sicherheitsinformati 05/04/2016 Robert Pollock Fünfte Version, onen" alternative Empfehlung zur Amplifikatsbewertung

Gergely Tölgyesi

V3

V4 V5

Gergely Tölgyesi

Gergely Tolgyesi Efi Melista

V6

05/05/2016 Fruzsina Felegyhazi

Sechste Version, Klein Efi Melista wörtlich Weschsel auf Qiagen Protokol hin

V7

05/06/2016 Fruzsina Felegyhazi

Siebente Version, DQB1 Set 1 & Set 2 Aktualisierung

Efi Melista

V8

05/08/2016 Fruzsina Félegyházi

Achte – Achtualisierung von dem Library

Efi Melista

Reagenzienvorbereitung Komponenten Box

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 5 │ 45



Haftungsausschluss Omixon hat nach größtem Bemühen dafür gesorgt, dass diese Gebrauchsanweisung (IFU) korrekt ist. Omixon haftet nicht für jegliche Ungenauigkeit oder Versäumnisse, die eventuell vorkommen können. Informationen in dieser IFU können ohne Mitteilung geändert werden. Omixon übernimmt keine Verantwortung für jegliche Ungenauigkeit, die in dieser Gebrauchsanweisung (IFU) enthalten sein können.

Omixon behält sich zu jeder Zeit das Recht vor, diese IFU und/oder die Produkte, die in dieser IFU beschrieben sind ohne weitere Mitteilungen zu verbessern.

Wenn Sie fehlerhafte, irreführende oder unvollständige Informationen in dieser Gebrauchsanweisung finden, begrüßen wir Ihre Anmerkungen und Vorschläge. Bitte schicken Sie diese zu [email protected]

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 6 │ 45





Herstellerinformationen Firmenname: Omixon Biocomputing Ltd Standortadresse: Fehérvári út 50-52/6 Stadt: Budapest Postleitzahl H-1117 Land: Ungarn



Symbolschlüssel



Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 7 │ 45





Inhalt des Holotype HLA-24/7 Konfiguration A1 & CE Kits Primer Component Box (Primer Komponenten Box) Die Primerkomponenten ermöglichen spezifische ready-to-use Lösungen zur gezielten LongRange PCR Amplifikation der HLA Gene A, B, DPB1, DQA1, DQB1 und DRB1. Zudem beinhaltet sie zwei Typen von Primer-Additiven (Enhancer 1 und Enhancer 2)

Primer Mix HLA-A HLA-B HLA-C HLA-DRB1 HLA-DQB1 (Set 1) HLA-DQB1 (Set 2) HLA-DQA1 HLA-DPB1 Enhancer 1 Enhancer 2

REF # P013 P023 P033 P043 P053 P063 P073 P083 E01 E02

Rxns 24 24 24 24 24 24 24 24 24 24

Menge/Gefäß 60 μL 60 μL 60 μL 60 μL 60 μL 60 μL 60 μL 60 μL 1100 μL 300 μL

# G 1 ef 1 ä 1 ß 1 e 1 1 1 1 1 1



Farbenkod e Gelb Rot Orange Grün Blau Schwar z Braun Lila Transp arent Transp arent

Library Preparation Reagents Component Box (Library Reagenzienvorbereitung Komponenten Box)

Die Library Preparation Component Box beinhaltet Reagenzien zur Vorbereitung der Library (Fragmentierung, Blunt-end und Polyadenylierung der Enden des Amplifikats und die Ligation der indizierten Adaptersequenz daran) des HLA Amplifikats.

Reagenz REF # Fragmentierungsenzym R12 (A) Fragmentierungspuffer (B) R22 End Repair-Enzym (C) R32 End Repair-Puffer (D) R42 Ligationsenzym (E) R52 Ligationspuffer (F) R62

Rxns 24

Menge/Gefäß 70 μL

24 24 24 24 24

70 μL 41 μL 82 μL 81 μL 900 μL



96-Well Adapter Platte

# G 1 ef äß 1 e 1 1 1 2

Farbenkod e Gelb Rot Grün Orange Blau Schwar z

Die 96-Well indizierte Adapterplatte beinhaltet ready-to-use induzierte NGS-Adapter (doppelsträngige DNA Oligonukleotide) in einer 5 μL Lösung zur Generierung individueller NGS Libraries. Die 96-Well indizierte Adapterplatte beinhaltet eine ausreichende Menge an indizierten Adaptern für die Generierung von 24 individuelle NGS-Libraries und für die Identifizierung von Downstream-Proben Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 8 │ 45





Reagenz Adapterplatte A1 (i1-24)

REF # N4

Rxns 24

Menge/Gefäß 5 μL

# Platt 1 e



Excel Workbook Das Excel Workbook wurde mitgeliefert, um das Protokoll des Holotype HLA 24/7 mit Kalkulationen, Plattenanordnungen, Bestandsführung, Erstellung eines MiSeq-Probenblattes und vieles mehr, zu unterstützen. Wenn Sie keine Kopie besitzen, kontaktieren Sie bitte [email protected]

Software – Omixon HLA Twin Kontaktieren Sie [email protected] für ein Omixon HLA Doppelguthaben verbunden mit ihrem Erwerb des Holotype HLA 24/7 Kits.

Wichtiger Hinweis:

Benutzen Sie alle drei Omixon Holotype HLA 24/7 Kit Komponenten und die Omixon HLA Twin Software in dem gleichen Arbeitsablauf, um einen Arbeitsablaufes für die In vitro-Diagnostik zu konstituieren! Bitte beachten sie den Abschnitt Warnhinweise und Vorsichtsmaßnahmen für die Anwendungsbeschränkungen des Produkts.

Austauschkomponente sind nach spezieller Anfrage erhältlich. Bitte beachten Sie, dass Omixon nur den Austausch von "Komponent Boxen" ermöglicht, nicht von einzelnen Fläschchen. Bitte kontaktieren Sie [email protected] für weitere Informationen.

Transport und Lagerung Transport auf Trockeneis-Packungen in Styropor-Transportboxen, kann nach Ankunft bei -20° gelagert werden. Bitte validieren Sie ihre Temperaturkontrolle und den Überwachungsprozess ihres Gefriergeräts und halten Sie ihn konstant. Ungeöffnete Kits sind bis zum Ablaufdatum des Kits haltbar (siehe Kit-Aufschrift) bei einer Lagerung bei -20 °C.

Nach Öffnen des Produktes wird die Produktstabilität für maximal vier (4) Gefrier/Tau-Zyklen gewährleistet. Die Kits sind nach dem Öffnen, bei einer Lagerung bei -20°, bis zu 3 Monate haltbar.

Warnhinweise und Vorsichtsmaßnahmen Produktbenutzungseinschränkungen

Für beste Leistungen benutzen Sie bitte die Arbeitsanweisungen des Holotype HLA 24/7 Kits und die Omixon HLA Twin Software für die HLA-Typisierung mittels NGS mit den Materialien, Reagenzien und dem Equipment empfohlen im Abschnitt "Equipment und Reagenzien". Die Benutzung anderer Materialien als im Abschnitt "Equipment und Reagenzien" beschrieben, müssen umfassend vom Benutzer überprüft und validiert werden! Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 9 │ 45





Bitte stellen Sie die Reagenzien nicht erneut her oder verdünnen Sie sie nicht anders als in der IFU beschrieben. Bitte benutzen Sie nicht weniger Mengen an Reagenz als in der IFU aufgeführt. Diese Handlungen können zu Leistungsfehlern führen! Omixon kann keine Unterstützung bei jeglichem Problem bieten, die aus Tätigkeiten resultieren, die von den Protokollschritten in der IFU abweichen. Bitte benutzen Sie das Produkt nicht im Falle von nachweisbaren Schäden der Komponente (gebrochene Gefäße, Platten, lockere Verschlüsse)!

Sicherheitsinformationen Lesen Sie den Abschnitt "Sicherheitsinformationen" und "Wichtige Hinweise" von jedem Reagenz oder Kit, geschildert im Abschnitt "Equipment, Reagenzien und Lieferung", vor dem Beginn gründlich durch. Wenn Sie mit Chemikalien arbeiten, tragen Sie bitte immer einen geeigneten Laborkittel, Einweghandschuhe und eine Schutzbrille. Für weitere Informationen ziehen Sie bitte die entsprechenden Sicherheitsdatenblätter (SDSs) des jeweiligen Materials hinzu, erhältlich bei dem Produkthersteller Ein Überblick über die chemischen Zusammensetzungen der Produkt-Reagenzien finden Sie in den SDSs des Holotype HLA 24/7 Kits und sind nach Anfrage erhältlich. Produktkomponente sollen als generell medizischer Abfall entsorgt werden.

Leistungsparameter Gängige Haupt-Leistungsparameter gemäß der Produktvalidierung.



HLA-A

HLA-B

HLA-DRB1

HLA-C

HLA-DPB1

HLA-DQA1

HLA-DQB1

Sensitivity

99.054%

99.171%

98.335%

96.310%

98.818%

98.927%

95.724%

Specificity

99.966%

99.982%

99.956%

99.863%

99.946%

99.881%

99.775%

Precision

99.054%

99.171%

98.335%

96.310%

98.818%

98.927%

95.724%

Accuracy

99.935%

99.965%

99.915%

99.736%

99.897%

99.785%

99.572%

Reproducibility

100.00%

100.00%

99.28%

100.00%

99.28%

100.00%

99.28%

Repeatability

100.00%

100.00%

100.00%

100.00%

100.00%

100.00%

100.00%







Technische Betreuung Zur generellen Betreuung dieses Protokolls kontaktieren Sie bitte [email protected]

Telefonische Betreuung: US | +1 (617) 500-0790 Europa | +36 70 574 8001 Rest der Welt | +1 (617) 500-0790



Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung

von In vitro-Diagnostik.

Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary



Seite 10 │ 45





Equipment, Reagenzien und Zubehör Technische und Geräteempfehlung § § § § § § §

Thermal Cycler mit 96-Well-Plattenformat Platten-Fluorometer (oder jedes andere Gerät zum Fluoreszenz-Nachweis im 96-WellPlattenformat zur Benutzung mittels Promega QuantiFluor dsDNA System) Pippin Prep (Cat# PIP0001) oder Blue Pippin (Cat# BLU0001) von SAGE Science qPCR-Gerät mit 96-Well- oder 384-Well-Plattenformat Illumina MiSeq (Cat# SY-410-1003) 64-bit Computer mit min. 4 Cores und 16 GB RAM Langfristige Datenspeicherung (ca. 2 TB Daten pro MiSeq pro Jahr)



Zugehörige Reagenzempfehlungen §

§

§ § §

§ § § § § §

LongRange PCR Kits von Qiagen (Cat# 206401, 206402 or 206403) § Jede Probe benötigt 4 μL Taq Polymerase § Cat# 206401 LongRange PCR kit (20) beinhaltet 8 μL Taq Polymerase § Cat# 206402 LongRange PCR kit (100) beinhaltet 40 μL Taq Polymerase § Cat# 206403 LongRange PCR kit (250) beinhaltet 100 μL Taq Polymerase ExoSAP-IT von Affymetrix (Cat# 78200, 78201, 78202 oder 78205) § Jede Mischprobe benötigt 4 μL ExoSAP-IT Enzym § Cat# 78200 beinhaltet 200 μL ExoSAP-IT Enzym § Cat# 78201 beinhaltet 1 mL ExoSAP-IT Enzym § Cat# 78202 beinhaltet 4 mL ExoSAP-IT Enzym § Cat# 78205 beinhaltet 10 mL ExoSAP-IT Enzym Library Quantification Kit –Illumina/Universal von KAPA Biosystems (Cat# KK4824) QuantiFluor dsDNA System von Promega (Cat# E2670) Agencourt AMPure XP beads von Beckman Coulter (Cat# A63880, A63881, oder A63882) § Jeder Holotype HLA-Lauf benötigt maximal 900 μL AMpure XP beads § Cat# A63880 beinhaltet 5 mL AMPure XP beads § Cat# A63881 beinhaltet 60 mL AMPure XP beads § Cat# A63882 450 mL AMPure XP beads Gel Apparatur, 1,5% Agarose, gefärbt nach internem Standard (Marker K/R2), für Pippin Prep/Blue Pippin (Cat# CDF1510 für Pippin Prep und BDF1510 für Blue Pippin) Molekular eingestuftes Ethanol (Anhydrischer Alkohol) Molekular eingestuftes Wasser (DNase und RNase frei) Natriumhydroxid 1XTE Puffer (pH 8,0) MiSeq Reagent Kit von Illumina o o o o o

MiSeq reagent kit von Illumina v2 (500-Zyklus) Cat# MS-102-2003 MiSeq reagent kit von Illumina v2 (500-Zyklus) Cat# MS-103-1003 MiSeq reagent kit von Illumina v2 (300-Zyklus) Cat# MS-102-2002 MiSeq reagent kit von Illumina v2 (300-Zyklus) Cat# MS-103-1002 MiSeq reagent kit von Illumina v2 (300-Zyklus) Cat# MS-103-1001

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 10 │ 45



MiSeq Reagent Kit Kapazität

Illumina MiSeq Reagent Kit Std 500 Zyklus (MS-102-2003)

Std 300 Zyklus (MS-102-2002)

Micro 300 Zyklus (MS-103-1002)

Nano 500 Zyklus (MS-103-1003)

Nano 300 Zyklus (MS-103-1001)

Zeit Stunden

24/7 Proben

~39

24

~24

24

~19

24

~28

12

~17

6



Empfohlenes Zubehör § § § § § § § § § § § § § § § §

1,5 mL Mikrozentrifugenröhrchen 1,5 mL low-bind Mikrozentrifugenröhrchen 2,0 mL low-bind Mikrozentrifugenröhrchen (Eppendorf DNA LoBind Cat# 022431048 empfohlen) justierbare Pipetten (1,0 –1000 μL) 8-Kanal-Pipetten, justierbar (2,0 - 500 μL) 96-Well-PCR-Platten passend zum Thermal Cycler 96-Well-PCR-Platten passend zum Platten-Fluorometer 96-Well-PCR-Platten passend zum qPCR-Gerät 96-Well Deep-Well Platten (>1000 μL) Plattenabdichtung zur generellen Benutzung Plattenabdichtungen kompatibel zum Thermal Cycler (getestet für LongRange-PCR) Optische Plattenabdichtungen kompatibel zum qPCR-Gerät Magnetischer Ständer (Magnetic Stand) kompatibel mit 2 ml Mikrozentifugenröhrchen 96-well Cooler Racks (2 Stück) 50 mL Falkonröhrchen 50 mL Reservoire

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 11 │ 45





Impressum Die Holotype HLA 24/7 IFU und deren Inhalt sind Eigentum von Omixon Biocomputing Limited ("Omixon"), und sind ausschließlich für die vertragliche Benutzung dessen Käufer unter Beachtung der nachstehend beschriebenen Produkte vorgesehen und für keinen anderen Zweck. Dieses Dokument und dessen Inhalt darf, ohne das vorherige schriftliche Einverständnis von Omixon, nicht für andere Zwecke benutzt oder verteilt und/oder übertagen, verbreitet oder reproduziert werden. Omixon überträgt mit diesem Dokument keine Patentlizenzen, Markenrechte, Copyright oder Rechte des Rechtssystems, noch ähnliche Rechte einer dritten Partei.

Omixon HLA Twin (“Software”) ist für den Käufer lizensiert unter den Bedingungen und Konditionen von Omixon HLA Twin EULA (www.omixon.com/hla-twin-eula/). Wenn Sie mit den darin stehenden Bedingungen und Konditionen nicht einverstanden sind, überträgt Omixon Ihnen keine Software-Lizenz und Sie dürfen die Software weder benutzen noch installieren.

Der Anleitung in diesem Dokument muss von qualifiziertem und genau trainiertem Personal genau und explizit gefolgt werden, um die sichere Benutzung des beschriebenen Produktes sicherzustellen. Der gesamte Inhalt dieses Dokuments muss vor der Benutzung des Produkts vollständig gelesen und verstanden werden.

VERSÄUMNISSE BEIM VOLLSTÄNDIGEN LESEN UND EXPLIZITEM BEFOLGEN DER GESAMTEN DARIN BEINAHLTENDEN INSTRUKTIONEN KANN ZU EINEM SCHADEN DES PRODUKTS, VERLETZUNG VON PERSONEN, DEM BENUTZER UND ANDEREN PERSONEN, UND ANDEREN SCHÄDEN FÜHREN.

OMIXON ÜBERNIMMT KEINE VERANTWORTUNG RESULTIEREND AUS DER UNSACHGEMÄßEN HANDHABUNG DER DARIN BESCHRIEBENEN PRODUKTE (ENTHALTENE BESTANDTEILE ODER SOFTWARE) ODER DER BENUTZUNG VON DIESEN PRODUKTEN AUßERHALB DES BEREICHES DER VERTRAGLICH GESCHRIEBENEN LIZENZ ODER GENEHMIGUNG, GEWÄHRLEISTET DURCH OMIXON IN VERBINDUNG MIT DEM KAUF DIESES PRODUKTES.



ZUR BENUTZUNG FÜR DIE IN VITRO DIAGNOSE ©2015 Omixon Biocomputing Ltd. Alle Rechte vorbehalten.

Verwendungszweck Das Holotype HLA 24/7 –Konfiguration A1 & CE Produkt (benannt als “Holotype HLA) ist eine Kombination von in-vitro Diagnostik-Test-Reagenzien und einer Datenanalyse-Software (Omixon HLA Twin™) und ist zur Identifizierung und Definition des Human Leukocyte Antigens (HLA) der Klasse I und Klasse II und zur Anwendung der HLA Typisierung unter Anwendung der Illumina® MiSeq Next Generation Sequencing Plattform gedacht. Das Holotype HLA bietet humane histokompatible Informationen des HLA Klasse I (A, B, und C) und Klasse II (DPB1, DQA1, DQB1 und DRB1) unter Verwendung humaner genomischer DNA. Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 12 │ 45





Die Omixon HLA Twin™ Software, beinhaltet im Holotype HLA Produkt, ist dafür gedacht, die im Illumina® MiSeq System generierten Daten zu interpretieren und zu vergleichen, um eine hohe Genauigkeit, Single-pass Allele Level HLA Typisierung mit sehr geringer Ungenauigkeitsrate bei dem 2 field Level zu erreichen. Das Holotype HLA Produkt wurde für die In vitro-Diagnostik entwickelt, benutzt von professionellem Personal im Gesundheitswesen, sowie Labortechnikern und Laborphysikern, trainiert in der HLA-Typisierung in Diagnostiklaboren, sowie EFI- oder ASHI-Akkordierte oder Personen die in der Lage sind, nach den Vorgaben der EFI oder ASHI zu arbeiten.

Wichtige Hinweise vor Beginn Empfohlene Genomische DNA Isolierung Humane genomische DNA (gDNA) sollte mit Hilfe von gut getesteten, kommerziell erhältlichen DNA Präparation Kits vorbereitet werden, um eine Konstanz der Präparierung sicherzustellen Ungeachtet dem Ansatz, ist eine akkurate Bestimmung der Konzentrationen und Reinheit für eine stabile Probenleistung erforderlich. Die DNA muss frei sein von Kontaminationen, die die spätere Amplifikation, Library Vorbereitung und Sequenzierungsschritte (z.B. Alkohol, Salze, Detergenzien, Formaldehyde und Heparin) beeinflussen können. Das Blut sollte nicht in heparinisierten Gefäßen verwendet werden und Blutproben von Patienten, die sich einer Heparintherapie unterziehen, und lipämische oder hämolysische Proben sollten nicht verwendet werden. Präparierte genomische DNA kann sofort verwendet werden, wenn sie in Nuklease-freiem Wasser oder über längere Zeit bei -20oC oder weniger in TE-Puffer gelagert wurde. Wiederholtes Gefrieren und Tauen sollte vermieden werden, um die Zersetzung zu reduzieren. Eine Konzentration von 20-30ng/µ DNA wird empfohlen, um 100-150 ng Input genomische DNA pro PCR-Amplifikation zu gewährleisten. Absorptionsgrad bei 260nm/280nm und 260nm/230nm vom Wert 1,7–2 wird sehr empfohlen.

Prinzip der Methode Über viele Jahre hat die HLA Gemeinschaft an einer Methode gearbeitet, die den umfassenden Polymorphismus des HLA-Gens und dessen Genprodukte genau identifiziert. Die Einführung der PCR verbunden mit anderen Technologien (Sanger sequencing, SSOP, SSP, Luminex), stellte eine Formel zur signifikanten Verbesserung des Nachweises des HLA-Polymorphismus bereit, jedoch mit etlichen Einschränkungen, die bis dahin führe, dass unsere Fähigkeit, eine umfassende Karakterisierung des HLA-Gens durchzuführen, gehemmt wurde. Die Technik, die in den letzten Jahren entwickelt wurde und zunehmend benannt ist als Next Generation Sequencing (NGS), hat neue Möglichkeiten bereitgestellt, die eine vollständige Karakterisierung von HLA-Genen in haploider Form ermöglichen. NGS besitzt zwei individuelle Eigenschaften, 1) klonale Sequenzierung von DNA-Fragmenten und 2) gewaltig hoher Datendurchlauf. NGS bietet die Fähigkeit, den Polymorphismus aufeinander abzustimmen und dadurch die Beseitigung von Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 13 │ 45



Zweideutigkeiten, und bietet HLA-Typisierung auf der drei-zu-vier Feldniveau ohne reflektierende Tests und dadurch die Einführung einer potenziellen Gesamtlösung des HLATypisierungsproblems. Das hier beschriebene Protokoll nutzt diese Technologie aus und kombiniert die LongRange PCR-Amplifikation von HLA-Genen mit der Sequenzierung auf einer Illumina MiSeq-Plattform. Noch spezieller werden die HLA-Gene A, B, C, DQA1 und DQB1 in ihrer gesamten Kodierungslänge amplifiziert, Elemente der 5’ und 3’end Untranslated Region eingeschlossen, währenddessen DRB1 vom Intron 1 bis zum Intron 4 und DPB1 vom Intron 1 bis zur 3’ Untranslated Region amplifiziert wird. Die Amplifikate werden dann durch eine Serie an Schritten bearbeitet: 1. Fragmentierung der Amplifikate auf eine Größe, geeignet zum Sequenzieren auf einer Illumina Plattform, 2. Blunt-end und Adenylierung der Enden der fragmentierten Amplifikate. 3. Binden der Adapter-Sequenzen, die durchgehend im Prozess im MiSeq zur Erfassung, Amplifizierung und Sequenzierung der DNA benutzt werden. Die Adapter beinhalten auch einen Index aus einem kurzem Sequenzabschnitt, gleich einem Adapter, der den Ursprung der Library identifiziert (Probe/Ort). Nach der Vereinigung der indizierten Libraries, Größenselektion und Bewertung, werden die Proben im MiSeq sequenziert. Der gesamte Prozess dauert 3-5 Tage, abhängig von der Wahl der Flow Cell auf der Illumina Plattform Die Zusammenfassung der Schritte im Protokoll wurde in der nachstehenden Abbildung dargestellt.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 14 │ 45





Zusammenfassung der Schritte

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 15 │ 45







Glossar/Definitionen § § § § § § § § § §

Amplifikate-Verdünnungsplatte – Eine 96-Well Deep-Well Platte zur Verdünnung der Amplifikate für die Bewertung Amplifikate-Platte - Alternativer Name für die Amplifikationsplatte; im Fall von DQB1 wird der Inhalt von beiden Amplifikationsplatten (Set 1 und Set 2) kombiniert. Amplifikate-Bewertungsplatte - 96-Well-Platte kompatibel zum Platten-Fluorometer, wo die verdünnten Amplifikate bewertet werden. Amplifikationsplatte – 96-Well PCR-Platte zur Amplifizierung der HLA-Orte. End-Library – Library, die alle Proben Libraries beinhaltet, fertig zur Sequenzierung in einem einzelnen MiSeq-Lauf. Reaktionsplatte – Platte, wo die Sequenzreaktion, wie Fragmentierung, End Repair, Ligation des Index-Adapters zu den Proben-Libraries durchgeführt wird. Reagenzplatte – Platte zum Aliquotieren der verschiedenen Reagenzien, um die Libraries vorzubereiten. Proben-Library – Library vorbereitet durch Kombination (Pooling) aller HLA-Orte für eine vorgegebene Probe. Proben-Libraries-Platte: Platte beinhaltet eine Proben-Library (alle Orte kombiniert) pro Well. Standards-Bewertungsplatte – 96-Well-Platte kompatibel zum Platten-Fluorometer, wo DNA Standards für die Amplifikate-Bewertung plaziert werden.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 16 │ 45





Schritt 1 – HLA Amplifikation Master Mix Vorbereitung Dauer: ~50 Minuten



Der Zweck dieses Schrittes ist es, den Ort-spezifischen Master Mix, zur individuellen Amplifizierung jedes gezielten HLA-Ortes, vorzubereiten. Die amplifizierten Orte in diesem Protokoll sind HLA-A, HLA-B, HLA-C, HLA-DRB1, HLA- DQB1, HLA-DPB1 und HLA-DQA1. Für HLA DQB1 sind 2 Primer Sets beigeliefert: Set 1 amplifiziert Exons 1-4 und Set 2 amplifiziert Exons 25. Set 2 ist nötig und ausreichend zur Erlangung akkurater Ergebnisse der Gentypisierung, sowie deren Amplifikate vom Intron 1 bis zur 3’UTR. Set 1, welches von der 5’UTR bis zum Intron 4 amplifiziert, hat eine Amplifikationsfehlerrate höher als empfohlen für eine verlässliche klinische Genotypisierung. Das HLA-DQB1 Set 1 ist fakultativ zur Verwendung in Applikationen, wo der komplette Umfang des DQB1 Gens nicht nötig ist. Notiz: Die vorbereiteten Master Mix in diesem Schritt beinhalten alle Reagenzien, die für die Amplifikation benötigt werden, mit Ausnahme des Taq Polymerase.



Liste der Reagenzien

Artikel HLA-A Primer Mix HLA-B Primer Mix HLA-C Primer Mix HLA-DRB1 Primer Mix HLA-DQB1 (Set 1) Primer Mix (Optional) HLA-DQB1 (Set 2) Primer Mix (Empfohlen) HLA-DPB1 Primer Mix HLA-DQA1 Primer Mix DQB Enhancer 1 DQB Enhancer 2 LongRange PCR Puffer (10×) dNTPs (10 mM jeweils) H2O (bidest.)

Lagerun g -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C

Geliefert durch Omixon Omixon Omixon Omixon Omixon Omixon Omixon Omixon Omixon Omixon Qiagen Qiagen Qiagen



Protokoll

1.1. - Entnehmen Sie alle Primer-Mix, DQB Enhancer 1 und 2, die dNTPs und den LongRange PCR Puffer (10×), aus der Lagerung, Auftauen bei Raumtemperatur.

1.2. - Vorbereitung der kombinierten DQB Enhancer: geben Sie 132 μL DQB Enhancer 2 in das DQB Enhancer 1-Gefäß. Umbeschriften Sie das DQB Enhancer 1-Gefäßes in kombinierter DQB Enhancer.

1.3. - Bereiten Sie einen Master Mix vor für jeden Primer Mix anhand der nachstehenden Tabelle: Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 17 │ 45





Master Mix: HLA-A, B, C, DRB1, DPB1 und DQA1 Reagenz Primer Mix LongRange PCR Puffer (10×) dNTP Mix (10 mM jeweils) H2O (bidest.) Gesamtvolumen

Volumen/Probe/locus 2 μL 2,5 μL 1,25 μL 13,85 μL 19,6 μL

Volumen/24 Proben/locus 51 μL 63,8 μL 31,9 μL 353,2 μL 499,9 μL



Master Mix: HLA-DQB1 Set 1 (Optional) and DQB1 Set 2 (Empfohlen)

Reagenz Primer Mix LongRange PCR Puffer (10×) dNTP Mix (10 mM jeweils) Kombinierter DQB Enhancer H2O (bidest.) Gesamtvolumen

Volumen/Probe/locus 2 μL 2,5 μL 1,25 μL 5,6 μL 7,85 μL 19,2 μL

Volumen/24 Proben/locus 51 μL 63,8 μL 31,9 μL 142,8 μL 200,2 μL 489,7 μL



1.4. – jeden Master Mix vortexen und für 1 Sekunde runterzentrifugieren. Master Mix auf Eis plazieren. 1.5. - alle gDNAs auf eine Konzentration zwischen 20-30ng/μL (minimum Volumen ist 45 μL) verdünnen.

Notiz: Holotype HLA beinhaltet genügend Reagenzien für 24 Reaktionen plus eine zusätzliche Menge zum Pipettieren verlorener und misslungener Amplifikationen.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 18 │ 45





Schritt 2 – HLA Klasse I und II Amplifikation Dauer: ~7 Stunden 40 Minuten Der Zweck von Schritt 2 ist die Amplifizierung der HLA-Orte. HLA Klasse I und Klasse II Amplifikationen wurden unter Verwendung von zwei separaten Sets von PCR-Bedingungen optimiert. Sind die PCR-Reaktionen vollständig, wird die Amplifikation mittels AgaroseGelelektrophorese verifiziert.

Liste der Reagenzien

Artikel HLA-A Master Mix HLA-B Master Mix HLA-C Master Mix HLA-DRB1 Master Mix HLA-DQB1 (Set 1) Master Mix HLA-DQB1 (Set 2) Master Mix HLA-DPB1 Master Mix HLA-DQA1 Master Mix Taq Polymerase gDNA H2O (bidest.)

Lagerun g -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C 4 °C 20 °C



Protokoll

Geliefert durch Schritt 1 Schritt 1 Schritt 1 Schritt 1 Schritt 1 Schritt 1 Schritt 1 Schritt 1 Qiagen Benutz er Benutz er

2.1 – das gelagerte Taq Polymerase runterzentrifugieren und zum Master Mix gemäß der nachstehenden Tabelle zugeben und durch gründliches Spülen der Pipetten mischen:

Taq Polymerase beladener Master Mix: HLA-A, B, C, DRB1, DPB1 und DQA1

Reagenz Master Mix von Schritt 1 Taq Polymerase Gesamt

Volumen/Probe/locus 19,6 μL 0,4 μL 20 μL

Volumen/24 Proben/locus 499,9 μL 10,2 μL 510,1 μL



Taq Polymerase beladener Master Mix: HLA-DQB1 Set 1 (optional) und HLA-DQB1 Set 2 (Empfohlen)

Reagenz Master Mix von Schritt 1 Taq Polymerase Gesamt

Volumen/Probe/locus 19,2 μL 0,8 μL 20 μL

Volumen/24 Proben/locus 489,7 μL 20,4 μL 510,1 μL

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 19 │ 45





2.2 - kurz vortexen und runterzentrifugieren aller Taq Polymerase-beladener Master Mixe. Aliquote von 20 μL von jedem Taq Polymerase-beladenen Master Mix in die separaten Wells der 96-Well PCR Platten.

Notiz: Amplifikation der Klasse I und Klasse II wurde unter Verwendung zwei verschiedener PCR-Konditionen optimiert, daher sollten die Master Mixe der Klasse I und Klasse II nicht in der gleichen Platte sein.

2.3 – 5 μL von jeder verdünnten gDNA in das entsprechende Well auf der Platte geben, wie vorangegangen beschrieben. Mixen durch Pipettieren. Versiegeln mittels thermalen Verschluss und visuelle Überprüfung jedes Wells. Alle Amplifikationsplatten in der Zentrifuge runterzentrifugieren.

2.4 – Die Amplifikationsplatten in den Thermal Cycler plazieren und das Programm für die Klasse I- und Klasse II-Amplifikation anhand der unten stehenden Tabelle laufen lassen:

Amplifikation der Klasse I (HLA-A, B und C)

Anzahl der Zyklen 1 35 1 1

Temperatur 95 °C 95 °C 65 °C 68 °C 68 °C 4 °C

Zeit 3 Minuten 15 Sekunden 30 Sekunden 5 Minuten 10 Minuten ∞



Amplifikation der Klasse II (HLA-DRB1, DQB1 Set 1, DQB1 Set 2, DPB1 und DQA1)

Anzahl der Zyklen 1 35 1 1

Temperatur 95 °C 93 °C 60 °C 68 °C 68 °C 4 °C

Zeit 3 Minuten 15 Sekunden 30 Sekunden 9 Minuten 10 Minuten ∞



2.5 - Verifizierung des Amplifikationserfolgs durch Lauf von 2 μL jedes Amplifikats in einem Standard 2% Agarose Gel bei 250 V für 30 Minuten.

Geschätzte Amplifikatsgrößen





HLA Ort HLA-A, B und C HLA-DRB1 HLA-DQB1 (Set 1) HLA-DQB1 (Set 2) HLA-DPB1 HLA-DQA1

Geschätzte Amplifikatsgröße (kb) ~3 kb ~4,3 kb ~4,7 kb ~5,8 kb ~4,5 kb ~4,5 kb

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 20 │ 45





Sichere Haltestelle. Amplifikate können bei 4 °C über Nacht oder bei -20 °C für länger gelagert werden.



Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 21 │ 45





Schritt 3 - Amplifikatsbewertung und -normalisierung (mittels Platten-Fluorometer) Dauer: ~1 Stunde Die Amplifikationsbewertung und -normalisierung wird zur Absicherung des genauen Inputs im Library-Vorbereitungsschritt empfohlen. Amplifikatskonzentration wird mittels eines QuantiFluor dsDNA Systems gemessen, was einen fluoreszierenden DNA-bindenden Farbstoff und einen DNA Standard beinhaltet, für eine sensitive Bewertung von kleinen Mengen von doppelsträngiger DNA (dsDNA). Als Alternative kann man statt des Platten-Fluorometers das qPCR-Gerät verwenden. Siehe Anhang 3 "Anweisungen zur Durchführung der Amplifikatsbewertung mittels qPCR-Gerät"

Liste der Reagenzien

Artikel Klasse I-Amplifikationplatte(n) Klasse II-Amplifikationplatte(n) Lambda DNA Standard (100 ng/μL) QuantiFluor dsDNA Dye (200×) 20×TE Puffer (pH 7.5) H2O (bidest.) ExoSAP-iT

Lagerung 4 °C 4 °C 4 °C 4 °C 4 °C 20 °C bis 25 °C -20 °C

Geliefert durch Schritt 2 Schritt 2 Promega Promega Promega Benutzer Affymetrix



Protokoll 3.1. Vorbereitung von DNA-Standards durch serielle Verdünnung von Lambda DNA Standards (100 ng/μL) mitgeliefert im QuantiFluor Kit anhand der nachstehenden Verdünnungstabelle:

Label auf dem Gefäß Standard 1 Standard 2 Standard 3 Standard 4 Standard 5 Standard 6 Blank

Input DNA

Volumen DNA (μL) Lambda DNA 7,5 μL Standard 1 250 μL Standard 2 250 μL Standard 3 250 μL Standard 4 250 μL Standard 5 250 μL Blank 0 μL

Volumen 1x TE (μL) 492,5 μL 250 μL 250 μL 250 μL 250 μL 250 μL 250 μL

End Konz. (ng/μL) 1,5 ng/μL 0,75 ng/μL 0,38 ng/μL 0,19 ng/μL 0,09 ng/μL 0,05 ng/μL 0 ng/μL



3.2. - Vorbereitung einer Amplifikate-Verdünnungsplatte für jeden Ort: in 96-Well Deep-WellPlatten Aliquote von 498 μ 1×TE Puffer und 2 μL des entsprechenden Amplifikats von der Amplifikate-Platte in jedes Well geben. Spülen der Pipettenspitzen durch Pipettieren. Versiegeln der Platten und gründlich vortexen. In einer Zentrifuge runterzentrifugieren.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 22 │ 45





3.3. - Vorbereitung einer 1×QuantiFluor gefärbten Arbeitslösung nach der nachstehenden Formel: 0,5 μL QuantiFluor Dye (200X) + 99,5 μL 1×TE Puffer. Vorbereitung einer ausreichend 1×QuantiFluor gefärbten Arbeitslösung, so dass jede Probe (gesamte Proben in der Amplifikat Platte) und ein Standard (gesamt 14) ein Aliquot von 100 μL erreicht.

3.4. – Vorbereitung einer Standards-Bewertungsplatte und Amplifikate-Bewertungsplatte. Aliquote von 100 μL 1×QuantiFluor gefärbter Arbeitslösung in die Wells einer frischen 96Well optischen Platten, unter Beibehaltung des Formats der Standards-Bewertungsplatte und der Amplifikate-Bewertunsplatte (siehe ergänzende Abbildung)



3.5. - Verwendung der zuvor vorbereiteten Standards, 100 μL eines jeden Standards als Kopie in die jeweiligen Wells auf der Standards-Bewertungsplatte füllen (gesamt 14 Wells). Mixen durch Pipettieren. 3.6. - Zugeben von 100 μL verdünntem Amplifikat aus den entsprechenden Wells in der Amplfikate-Verdünnungplatte in die Amplifikate-Bewertungsplatte. Mixen durch Pipettieren.



3.7. - Lauf der Standards-Bewertungsplatte im Platten Fluorometer sowie der AmplifikateBewertungsplatte.





3.8. - Kalkulation der DNA-Konzentration in den Amplifikate-Bewertungsplatten mittels RFUDaten. Siehe Verdünnungstabelle im bereitgestellten Workbook zur Hilfestellung von Kalkulationen. 3.9. Verdünnung der DNA in den Amplifikateplatten mit H2O bidest., so dass die DNAEndkonzentration etwa 67 ng/μL beträgt. • Im Fall einer DNA-Konzentration von 150 ng/μL oder mehr: Zugabe von 25 μL H2O • Im Fall einer DNA-Konzentration zwischen 100-150 ng/μL: Zugabe von 10 μL H2O • Im Fall einer DNA-Konzentration weniger als 100 ng/μL: keine Zugabe von H2O 3.10 - Mischen jeder Probe mit 15 μL DQB1 (Set 1) und DQB1 (Set 2) in einem neuen Well (wenn beide DQB1 Sets benutzt werden).





Notiz: DQB1 Set 1 und Set 2 amplifizieren beide Exons 2, 3 und 4. Falls eine der DQB1 Reaktionen misslingt oder ist signifikant weniger als bei den anderen Reaktionen, sollte sie nicht mit einer erfolgreichen Reaktion vermischt werden. Das verhindert die Verdünnung einer guten Amplifikation. 3.11 - Vereinige alle Orte einer Probe in einer einzelnen Amplifikateplatte 5 μL von jedem Ort einer Probe in einer neuen 96-Well PCR-Platte zusammenfügen. Jede Probe sollte ein einzelnes Well besetzen mit einem Volumen von 35 μL. Wenn das Endvolumen jeder Probe aufgetragen wurde, gut durch Pipettieren mischen.



3.12 – Zugabe von 4 μL ExoSAP-iT in ein zusammengefügtes Amplifikat. Spülen der

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 23 │ 45



Pipettenspitzen durch Pipettieren. Versiegeln der Platte mit einer thermalen Versiegelung und runterzentrifugieren.

3.13 - Die Amplifikateplatte in dem Thermal Cycler plazieren und das folgende Programm durchführen:

ExoSAP-IT PCR-Reinigung

Anzahl der Zyklen 1 1 1

Temperatur 37 °C 80 °C 4 °C

Zeit 45 Minuten 15 Minuten ∞



Sichere Haltestelle. Amplifikat kann bei 4 °C über Nacht oder bei -20 °C für länger gelagert werden.



Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 24 │ 45





Schritt 4 – Library Vorbereitung Dauer: ~3 Stunden 20 Minuten



Während dieses Schrittes werden die zusammengefügten Amplifikate für die Sequenzierung am Illumina MiSeq vorbereitet. Die Amplifikate sind enzymatisch fragmentiert, die Enden sind repariert und adenylisiert und indizierte Adapter sind an die Enden ligiert. Die Libraries werden nun durch einen einfachen Aufreinigungs- und Konzentrationsschritt mit Hilfe von AMPure XP beads gepoolt. Notiz: Omixon empfiehlt größere Volumen, als die, die für 24 Proben notwendig sind, weil viele der Enzyme und Puffer dickflüssig sind, was zu einem übermäßigen Verlust beim Pipettieren führen kann.



Liste der Reagenzien

Artikel Amplifikate-Platte Adapterplatte Fragmentierungsenzym (A) Fragmentierungspuffer (B) End Repair-Enzym (C) End Repair-Puffer (D) Ligationsenzym (E) Ligationspuffer (F) AMPure XP beads 80% Ethanol (frisch zubereitet) H2O (bidest.)

Protokoll

Lagerung 4 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C 4 °C 20 °C bis 25 °C 20 °C bis 25 °C

Geliefert durch Schritt 1 Omixon Omixon Omixon Omixon Omixon Omixon Omixon Beckman Coulter Benutzer Benutzer

4.1 - Anschalten des Thermal Cyclers. Überprüfung, ob die Heizdeckel sich aufwärmen. Notiz: Vor der Benutzung das Fragmentation Enzyms (A) gründlich durch vortexen aufmischen. 4.2 - Vorbereitung des Fragmentation Master Mix anhand der nachstehenden Tabelle:

Fragmentation Master Mix

Reagenz Fragmentierungsenzym (A) Fragmentierungspuffer (B) Gesamtvolumen

Volumen pro Library (μL) 2 μL 2 μL 4 μL

Empfohlenes Volumen für 24 Libraries (μL) 55,2 μL 55,2 μL 110,4 μL

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Farbenkod e Gelb Rot

Seite 25 │ 45





4.3 - Vorbereitung einer Reagenz-Platte: eine neue 96-Well PCR-Platte auf ein PCR Kühl-Rack plazieren und gleiche Mengen des Fragmentation Master Mixes in jedes Well einer einzelnen Säule aliquotieren.







Notiz: Die Fragmentierungsreaktion wurde designt, um ideal große DNA zur Sequenzierung im Illumina MiSeq bereitzustellen. Es ist wichtig, die Reagenzien bis zum Start der Reaktion im Thermal Cycler, kalt zu stellen, um einer exzessiven Fragmentierung vorzubeugen. Benutzung von Mehrkanal-Pipetten werden empfohlen, um der Möglichkeit einer exzessiven Fragmentierung vorzubeugen. 4.4 - Zentrifugieren der Amplifikate-Platte für 10 Sekunden und kühlen auf Eis oder auf einem Kühlblock 4.5 - Vorbereitung der Reaktionsplatte: Plazieren einer neuen 96-Well PCR Platte auf einen PCRKühlblock.



4.6 - Zugabe von 4 μL Fragmentation Master Mix von der Reagenzplatte in die Wells auf der Reaktionsplatte entsprechend der Proben in der Amplifikate-Platte. Die Benutzung einer Mehrkanal-Pipette wird empfohlen.

4.7 - Übertragung von jeweils 4 μL Fragmentation Master Mix von jedem Amplifikat von der Amplifikate-Platte in das entsprechende Well auf der Reaktionsplatte mittels MehrkanalPipette Mixen durch Pipettieren.

4.8 - Abdecken der Reaktionsplatte mit einer thermalen Versiegelung und 10 Sekunden runterzentrifugieren.

4.9 - Inkubation der Reaktionsplatte im Thermal Cycler mit folgendem Programm:

Fragmentierungsprogramm

Anzahl der Zyklen 1 1 1

Temperatur 37 °C 70 °C 4 °C

Zeit 10 Minuten 15 Minuten ∞



Sichere Haltestelle. Lagerung der Libraries bei 4 °C über Nacht oder bei -20 °C für länger

4.10 - Vorbereitung des End Repair Master Mix anhand der nachstehenden Tabelle.



Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 26 │ 45





End Repair Master Mix

Reagenz H2O (bidest.) End Repair-Enzym (C) End Repair-Puffer (D) Gesamtvolumen

Volumen pro Library (μL) 1,25 μL 1,25 μL 2,5 μL 5 μL

Empfohlenes Volumen für 24 Libraries (μL) 34,8 μL 34,8 μL 69,6 μL 139,2 μL



Farbenkod e Grün Orange





4.11 - Aliquotieren gleicher Mengen des End Repair Master Mixes in einzelne unbenutzte Säulen der Reagenzplatte.

4.12 - Zentrifugieren der Reaktionsplatte (beinhaltet die fragmentierten Proben) für 10 Sekunden. Zugabe von 5 μL End Repair Master Mix von der Reagenzplatte in jedes Well der Reaktionslatte. Die Benutzung einer Mehrkanal-Pipette wird empfohlen. Mixen durch Pipettieren.

4.13 - Abdecken der Reaktionsplatte mit einer thermalen Versiegelung und 10 Sekunden runterzentrifugieren.

4.14 - Inkubation der Reaktionsplatte im Thermal Cycler mit folgendem Programm:

End Repair Programm

Anzahl der Zyklen 1 1 1

Temperatur 20 °C 65 °C 4 °C

Zeit 30 Minuten 30 Minuten ∞



Sichere Haltestelle. Lagerung der Libraries bei 4 °C über Nacht oder bei -20 °C für länger



4.15 - Die mitgelieferte Adapterplatte bei Raumtemperatur auftauen, nachdem das End RepairProgramm im Thermal Cycler gestartet wurde. Wenn die Adapterplatte bei Raumtemperatur ist, für 3 Minuten bei 3000 rpm zentrifugieren. 4.16 - Vorsichtiges Abziehen der Versiegelung der Adapterplatte Nicht die Adapterplatte schütteln, nachdem die Versiegelung entfernt wurde, um eventuellen Kreuzkontaminationen vorzubeugen.

4.17 - Übertragen des gesamten Volumens jedes Wells von der Reaktionsplatte (25 μL) in das entsprechende Well auf der Adapterplatte.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 27 │ 45







Notiz: Wird NICHT die gesamte Adapterplatte verwendet, es ist möglich nur die benötigte Anzahl an Adaptern zu verwenden. Die Plattenversiegelung zwischen den Wells, die verwendet werden und den Wells, die verbleiben, zerschneiden. Vorsichtiges Abziehen zwischen der Versiegelung der Adapterplatte lässt das Versiegelung über den Wells, die nicht benutzt werden, an seinem Platz.



a. Übertragung von 25 μL jeder End repair-Probe in der Reaktionsplatte in ein Well in der Adapterplatte, gründliches Mischen durch pipettieren. b. Übertragung der Gesamtmenge einer jeden Probe von der Adapterplatte in das original Well auf der Reaktionsplatte. c. Wiederversiegeln der Adapter-Platte und Rückkühlen auf -20 °C. Benutzen der Reaktionsplatte anstelle der Adapter-Platte für die übrigen Schritte im Handbuch.

4.18 - Vorbereitung des Ligation Master Mix. Vorbereitung von ausreichend Ligation Master Mix für jede Probe.

Ligation Master Mix

Reagenz Ligationsenzym (E) Ligationspuffer (F) Gesamtvolumen

Volume (μL) 2,5 μL 30 μL 32,5

Empfohlenes Volumen für 24 Libraries (μL) 63,2 μL 757,5 μL 820,7 μL



Farbenkod e Blau Schw arz

4.19 - Den Ligation Master Mix in eine unbenutzte Säule auf der Reagenzplatte aliquotieren. Die Benutzung einer Mehrkanal-Pipette wird empfohlen.

4.20 - Zugabe von 32,5 μL Ligation Master Mix in jedes Well auf der Reaktionsplatte. Die Benutzung einer Mehrkanal-Pipette wird empfohlen. Mixen durch Pipettieren.

4.21 - Abdecken der Reaktionsplatte mit einer thermalen Versiegelung und 10 Sekunden runterzentrifugieren.

4.22 - Inkubation der Reaktionsplatte im Thermal Cycler mit folgendem Programm:

Ligationsprogramm

Anzahl der Zyklen 1 1 1

Temperatur 25 °C 65 °C 4 °C

Zeit 10 Minuten 20 Minuten ∞



Sichere Haltestelle. Lagerung der Libraries bei 4 °C über Nacht oder bei -20 °C für länger

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 28 │ 45







4.23 - Aufwärmen der AMPure XP beads (Magnetpartikel) auf Raumtemperatur. Sicherstellung, dass sie homogen sind (keine Klumpen oder Pellets) Vorbereiten des frisch hergestellten 80% Ethanols (4ml Ethanol + 1 ml H2O). 4.24 - Erstellung der Library durch Kombination eines Aliquots von jeden zusammengefügtem Amplifikat, jetzt eine Proben-spezifische Library, in eine 2,0 ml low-binding Mikrozentrifugenröhrchen. a. Für 16 oder mehr Proben - Kalkuliere die Menge einer jeden Proben-Library, um sie zu einer einzelnen Library mit einem Gesamtvolumen von 900 μL zusammenzufügen. 900 μL auf die Anzahl der Proben-Libraries verteilen. Dies ist das Volumen eines Aliquots, was von jeder Proben-Library besetzt und in die Library pipettiert werden kann. b. Für weniger als 16 Proben - Übertragen von 60 μL jeder Proben-Library in die Library.



4.25 - Zugabe von 900 μL AMPure XP beads in das Library-Röhrchen. Gründlich Mischen durch vortexen und kurzes runterzentrifugieren Magnetpartikel dürfen sich nicht separieren. Inkubation der Library für 10 Minuten bei Raumtemperatur.





Notiz: Falls weniger als 900 μL Library im End-Pool sind, Zugabe einer äquivalenten Menge an AMPure XP Beads. Es sollte ein Verhältnis von 1:1 zwischen End-Pool und AMPure XP Beads vorliegen. 4.26 - Platzierung des Library-Röhrchen auf den Magnetischen Ständer und Inkubation für 10 Minuten.



4.27 - Das Röhrchen auf dem Magnetischen Ständer halten. Vorsichtiges Entfernen und Verwerfen des Überstandes aus dem Library-Röhrchen, ohne die Magnetpartikel zu berühren.

4.28 - Das Röhrchen auf dem Magnetischen Ständer halten. Zugabe von ~1,5 mL frisch hergestelltem 80% Ethanol in das Library-Röhrchen. Das Volumen des zugefügten Ethanols sollte ausreichen, um die Magnetpartikel zu bedecken.

Notiz: Verwendung des Ethanols auf der Seite des Röhrchens ohne Magnetpartikel. 4.29 - Inkubation des Library-Röhrchens bei Raumtemperatur für 30 Sekunden, anschließend vorsichtges Entfernen und Verwerf des Überstandes.

4.30 - Wiederholug von Schritt 4.28 und 4.29.

4.31 - Schnelles runterdrehen des Library- Röhrchens und Rückplazierung in den Magnetischen Ständer mit offenem Deckel. Entfernen von Rest-Ethanol mit einer Pipette. Nicht die Magnetpartikel berühren

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 29 │ 45







Notiz: Sicherstellen, dass das Magnetpartikel-Pellet keinen Rest-Ethanol enthält. Dies könnte eine Rotation des Gefäßes auf dem Magnetischen Ständer benötigen, um das Ethanol zu entfernen ohne das Pellet aufzuwühlen. 4.32 - Das Pellet für 5-8 Minuten auf dem Magnetischen Ständer lufttrocken bis das Magnetpartikel-Pellet trocken ist.



4.33 - Entfernen des Library-Röhrchens vom Magnetischen Ständer und Eluieren der Library mit 31 μL H2O bidest. Nicht mit der Pipettenspitze die Magnetpartikel berühren, solange sie anhaften.



4.34 - Vortexen der Library bis zur vollständigen Auslösung der Magnetpartikel. Kurzes Zentrifugieren, falls einige Tröpfchen an der Seitenwand verharren. Sicherstellen, dass die Beads in der Suspension vorhanden sind. 4.35 - Inkubation der Library bei Raumtemperatur für 2 Minuten.





4.36 - Das Library-Röhrchen für 2 Minuten auf dem Magnetischen Ständer plazieren. 4.37 - Sammeln der Library: Das End-Library-Röhrchen in den Magnetischen Ständer stellen, 31 μL vom Überstand in einem 1,5 ml low-binding Mikrozentrifugenröhrchen sammeln.

Sichere Haltestelle. Lagerung der Libraries bei 4 °C über Nacht oder bei -20 °C für länger.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 30 │ 45





Schritt 5 – Library-Größenauswahl Dauer: ~1 Stunde Schritt 5 benutzt die Library aus Schritt 4 und führt eine Größenselektion mittels Pippin Prep durch. Das Pippin Prep kann automatisch einen Bereich an DNA Fragmentgrößen selektieren und in eine Sammelkammer eluieren. Notiz: Blue Pippin kann anstelle von Pippin Prep verwendet werden. Bezogen auf Anhang 1 für eine Anleitung zur Benutzung von Pippin Prep

Liste der Reagenzien

Artikel 1,5% Agarose Gel Kassette, Farbstoff frei Pippin Loading Solution/Marker Mix (Label K) Vereinigte Library

Lagerung 20 °C bis 25 °C 4 °C

Geliefert durch Sage Science Sage Science

4 °C

Schritt 4





Notiz: Marker K wird zusammen mit dem Pippin Prep verwendet Das Blaue Pippin benutzt Marker R2.



Protokoll

5.1 - Die Marker K Loading Lösung auf Raumtemperatur bringen. 5.2 - Kombiniere 31 μL der Vereinigung mit 10 μL Marker K Loading Lösung.



5.3 - Mixen durch vortexen und anschließendes Zentrifugieren.

5.4 - Aufbau der Pippin Prep zum Sammeln von DNA Fragmenten zwischen 650 und 1300 bps. 40 μL Probe in die Probenöffnung laden und laufen lassen. Laufzeit beträgt 45-50 Minuten.





5.5 - Sammeln des gesamten Inhalts (ca. 40 μL aus der Elutionsöffnung des Pippin prep und Übertragung in ein neues 1,5 ml low-binding Mikrozentrifugenröhrchen. Dies ist die Größenselektions-Library. Sichere Haltestelle. Lagerung der Libraries bei 4 °C über Nacht oder bei -20 °C für länger.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 31 │ 45



Schritt 6 –Library Bewertung Dauer: ~1 Stunde Für einen optimalen Gebrauch des Outputs des Illumina MiSeq Sequencers ist es nötig die Größenselektions-Library zu quantifizieren. Die Konzentration der Größenselektions-Library kann mittels qPCR akkurat gemessen werden.

Liste der Reagenzien

Artikel 10×Illumina Primer Premix 2×KAPA SYBR FAST qPCR Master Mix Std 1 (20,00 pM) Std 2 (2,00 pM) Std 3 (0.20 pM) Std 4 (0,02 pM) Illumina DNA Standards H2O (bidest.) 1×TE Puffer (pH 8.0) Größenselektions-Library

Protokoll

Lagerung -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C -20 °C

4 °C

Geliefert durch KAPA Biosystems KAPA Biosystems KAPA Biosystems KAPA Biosystems KAPA Biosystems KAPA Biosystems KAPA Biosystems Benutzer Benutzer Schritt 5

6.1 - Vorbereitung des qPCR Primer Mix mittels 10×Illumina Primer Premix und 2×KAPA SYBR FAST qPCR Master Mix: Notiz: Die KAPA SYBR FAST qPCR Kit Reagenzien (qPCR Master Mix, Primer Premix und ROX Lösung) werden bei der ersten Benutzung des Kits kombiniert. Die kombiniete Lösung ist für 30 Gefrier/Tau-Schritte stabil. Zur Bestimmung der KAPADokumentation folgen, falls ROX für ihr qPCR Gerät empfohlen wird.



qPCR Primer Mix

Reagenz 10×Illumina Primer Premix 2×KAPA SYBR FAST qPCR Master Mix Gesamtvolumen

Volumen (ml) 1 mL 5 mL 6 mL



6.2 - Vorbereiten des qPCR Master Mix.



Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 32 │ 45





qPCR Master Mix

Reagenz qPCR Primer Mix H2O (bidest.) Gesamtvolumen

Volumen (μL) 228 μL 76 μL 304 μL



6.3 - Vorbereitung einer Reihenverdünnung der Größenselektions-Library

a. Vorbereitung einer 1 :1000 Verdünnung durch Zugabe von 1 μL der Größenselektions-Library zu 999 μL 1xTE Puffer (pH 8.0), gründliches Spülen der Pipettenspitze. Vortexen und runterzentrifugieren. b. Vorbereitung einer 1 :2000 Verdünnung durch Zugabe von 100 μL der 1:1000 Verdünnung zu 100 μL 1xTE Puffer (pH 8.0). Vortexen und runterzentrifugieren. 6.4 - Vorbereitung der qPCR-Bewertungsplatte in einer neuen PCR-Platte kompatibel zum PCRSystem



6.5 - 16 μL qPCR Master Mix in dreifacher Ausfertigung für die Standards 1-4 aliquotieren, Verdünnung 1:1000 und Verdünnung 1:2000 (siehe ergänzende Abbildung). 6.6 - 4 μL des Standards 1-4, Verdünnung 1:1000 und Verdünnung 1:2000 in die entsprechenden Wells aliquotieren. 6.7 - Versiegelung der qPCR-Bewertungsplatte und für 10 Sekunden zentrifugieren. Notiz: Die Bildung von Blasen sollten auf der PCR-Bewertungsplatte vermieden werden. Das Zentrifugieren wird zum Beseitigen der Blasen benötigt.

6.8 - DNA-Konzentration der Größen-selektierten Library mittels qPCR Gerät bestimmen.





6.9 - Mit Hilfe der Ergebnisse der qPCR, 10 μL der Größen-selektierten Library zu einer Konzentration von 2 nM mit sterilem H2O in frischen 1,5 mL low-binding Mikrozentrifugenröhrchen verdünnen. Die verbliebene Größen-selektierten Library kann bei -20 °C gelagert werden. Sicherer Haltestelle. Lagerung der Libraries bei 4 °C über Nacht oder bei -20 °C für länger. Im Falle einer Lagerung über einen längeren Zeitraum, wird eine ReQuantifizierung der Library dringend empfohlen, bevor sie in der MiSeq eingesetzt wird.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 33 │ 45





Schritt 7 –Sequenzierung am Illumina MiSeq Duration: ~20 - 40 Stunden



Der Illumina MiSeq ist ein automatisiertes NGS Gerät, dass die im vorherigen Schnitt vorbereitete Größenselektions-Library sequenziert. De-Multiplexing der indizierten Proben erfolgt automatisch durch die Beendigung des Sequenzierungslaufs. Kurzhinweis – man kann einen 1% PhiX spike-in als zusätzliche Kontrolle verwenden, um die Sequenzreaktion zu überwachen. Für weitere Informationen zur PhixKontrolle wenden Sie sich bitte an die Dokumentation von Illumina



Liste der Reagenzien

Artikel Reagenzpatrone HT1 PR2 MiSeq Flow Cell Library bei 2nM NaOH 1 N oder 2 N H2O (bidest.)

Lagerung -20 °C -20 °C 4 °C 4 °C 4 °C 20 °C bis 25 °C 20 °C bis 25 °C



MiSeq Reagent Kit Kapazität

Geliefert durch Illumina Illumina Illumina Illumina Schritt 6 Benutze r Benutze r



Illumina MiSeq Reagent Kit Std 500 Zyklus (MS-102-2003)

Std 300 Zyklus (MS-102-2002)

Micro 300 Zyklus (MS-103-1002)

Nano 500 Zyklus (MS-103-1003)

Nano 300 Zyklus (MS-103-1001)

Zeit Stunden

X2-24/7 Proben

~39

24

~24

24

~19

24

~28

12

~17

6



Protokoll 7.1 - Vorbereitung der Miseq anhand der Standard Illumina Protokolle.

7.2 - Vorbereitung einer 1 nM denaturierten Library: Kombiniere 10 μL frisch zubereitetem 0,2 N NaOH und 10 μL 2 nM verdünntes Größen-selektierter Library in einem neuen 1,5 mL lowbinding Mikrozentrifugenröhrchen.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 34 │ 45





Vortexen und runterzentrifugieren. Inkubation dieser 1 nM denaturierten Library bei Raumtemperatur für 5 Minuten.

7.3 - Vorbereitung einer 20 nM denaturierten Library: 980 μL gekühlte HT1 zu 20 μL 1 nM denaturierter Library hinzugeben. Vortexen und runterzentrifugieren.





7.4 - Vorbereitung einer 9 nM denaturierten Library: 550 μL gekühlte HT1 zu 450 μL 20 nM denaturierter Library in ein neuen 1,5 mL low-binding Mikrozentrifugenröhrchen pippetieren. Vortexen und runterzentrifugieren. 7.5 - Übertragung von 9 pM denaturierter Library in das Proben Ladebehälter der MiSeq Reagenzpatrone. Kurzhinweis – Es ist empfehlenswert das empfohlene Workbook zu benutzen, das von Miseq benötigt wird, um das Probenblatt zu erstellen.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 35 │ 45





Schritt 8 – Analyse der HLA Sequenzdaten Das Illumina MiSeq arbeitet die 9 pM vereinigte Library auf und generiert die Sequenzdaten als fastq File. Bitte beziehen Sie sich auf des HLA Twin Handbuch zur Unterstützung der korrekten Installation von HLA Twin und zu Informationen zur Interpretation der Genotyp-Analyse ihrer Sequenzdaten. Für die Inbetriebnahme des Automatisierte Protokolls und Fragen zur Installation oder Datenanalyse kontaktieren Sie bitte [email protected]

Automatisches Protokoll IT Setup und Konfiguration 1. § §

Installation des HLA Twin Servers auf dem Server Installation des HLA Twin Client auf den Client Computer - multiple HLA Twin Clienten könnten sich zum Server verbinden Kontaktieren Sie Omixon Support ([email protected]) für die InstallationsGebrauchsanleitung für die Automatisierung.



Protokoll per Analyse 1. 2. 3.

Starten des HLA Twin Client und Einloggen. Daten sind bereits bearbeitet oder werden bearbeitet. Überprüfung der Ergebnisse mittels Traffic Light System in HLA Twin. Die Ergebnisse der Genotypen und/oder Konsensus-Sequenzen können wie folgt exportiert werden.



Manuelles Server Protokoll IT Setup und Konfiguration § §

Installation des HLA Twin Servers auf den Server. Installation des HLA Twin Client auf dem Client Computer.

Protokoll per Analyse § § § §



Starten des HLA Twin Client und Einloggen. Die MiSeq Datei im .fastq oder .fastq.gz Format auswählen und den Holotype HLA Typisierungslaufs starten. Nachdem die Holotype HLA Typisierung beendet ist, können die Ergebnisse mittels Traffic Light System im HLA Twin überprüft werden. Die Ergebnisse der Genotypen und/oder Konsensus-Sequenzen können wie folgt exportiert werden.

Manuelles Desktop Protokoll IT Setup und Konfiguration §

HLA Twin Desktop installieren.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 36 │ 45





Protokoll per Analyse 7 8 9 10



Starten des HLA Twin Client und Einloggen. Die MiSeq Datei im .fastq oder .fastq.gz Format auswählen und den Holotype HLA Typisierungslaufs starten. Nachdem die Holotype HLA Typisierung beendet ist, können die Ergebnisse mittels Traffic Light System im HLA Twin überprüft werden. Die Ergebnisse der Genotypen und/oder Konsensus-Sequenzen können wie folgt exportiert werden.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 37 │ 45





Ergänzende Abbildungen Plattenbeispiele für eine Amplifikate-Platte, Amplifikationsplatte, Verdünnungsplatte, Amplifikate-Bewertungsplatte (für einen individuellen Ort) & Reaktionsplatte



Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 38 │ 45





Beispiel einer Standard-Berwertungsplatte



qPCR-Plattenbeispiel





Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 39 │ 45



Anhang 1: Pippin Prep Programmierung von Pippin Prep 1.

Das Protocol Editor-Verzeichnis anklicken und den Knopf “New” anklicken.

2.

Das "Folder"-Symbol neben dem "Cassette"-Feld anklicken und “1.5%DF Marker K” für die Pippin Prep oder “1.5%DF Marker R2” für die Blue Pippin auswählen.

3. In der Spur, die programmiert wird: Das “Range”-Feld hervorheben. Setzten einer “Ref Spur”, um die Anzahl der Spuren, die benutzt werden, anzugleichen. Das “Start*”-Feld auf 650 stellen. Das “End*”-Feld auf 1300 stellen. 4. In dem "Reference Lane"-Feld, die Spur auswählen, in der gearbeitet wird.

5.

Auf den Knopf "Save as" drücken und dem Programm einen Namen geben.



Lauf der Pippin Prep 1. 2. 3. 4. 5. 6. 7. 8.

9.

10.

11.

Mit Hilfe des Anschaltknopfes auf der Hinterseite des Pippin Prep das Gerät anschalten. Visuelle Überprüfung des Pippin Prep. Sicherstellen, dass alle 5 LEDs leuchten und dass das Gerät im Innenraum sauber und trocken ist. Rechts auf dem Bildschirm auf den "Sage Science logo"-Knopf klicken. Es kann jetzt ein Passwort eingegeben werden. Das Betriebsstandard-Passwort ist “pips”. Auf das "Factory-Setup"-Verzeichnis klicken und sicherstellen, dass das der "Base-toThreshold"-Wert auf 0,02 gesetzt ist. Den Kalibrierungsaufsatz in das Pippin Prep platzieren. Sicherstellen, dass der dunkle Streifen mit der Schriftseite nach unten und über den LED-Lichtern platziert wurde. Im "Main"-Verzeichnis auf den Knopf “Calibration” klicken. Im "Calibration"-Fenster überprüfen, ob das “Target I pH mA”-Feld auf 0,80 (0,06 für Blue Pippin) gesetzt ist und dann den "Calibrate"-Knopf drücken. Ins "Protocol"-Verzeichnis gehen. Den “Load”-Knopf anklicken und das Programm für den Holotype HLA und die spezielle Spur, die verwendet werden soll, anklicken Sicherstellen, dass: a. Die korrekte Spur angeschaltet ist. b. Der Breitspektrum-Selektionsindikator an ist. c. Die Referenzspur in der gleichen Spur ist, die verwendet wird. Zum "Main"-Verzeichnis gehen. Sicherstellen, dass: a. Das geladene Programm das ist, das ausgewählt worden ist. b. Die entsprechende Referenz-Spur ausgewählt wurde und das es auch die Spur ist, in der die Proben laufen. Überprüfen der Kassette. Bevor das Band zur Versiegelung entfernt wird, sollte sichergestellt werden, dass sich keine Blasen hinter der Elutionsöffnung befinden. Wenn man hinter der Elutionsöffnung Blasen erkennt, die Kassette behutsam in der Hand nehmen und die Basen rausklopfen und -rollen. Die Kassette mit dem noch über den Wells befindlichen Band in das Pippin Prep stellen.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 40 │ 45





12.

13. 14. 15.

16. 17. 18.

19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 32.

Vorsichtig das Band ablösen und darauf achten, dass das Band von der sauberen Seite der Kassette (Spur 5) aus zur benutzten Seite der Kassette (Spur 1) abgelöst wird. Aufpassen, dass die Flüssigkeit beim Entfernen des Bandes nicht spritzt, um eine Kontamination zu vermeiden. Das ganze Volumen des Puffers in der Elutionöffnung der Spur, die verwendet wird, entfernen und durch 40 μL frisch hergestellten Elektrophoresepuffer in der Elutionsöffnung ersetzen. Einen dünnen Streifen des Bandes über die Elutionsöffnung geben. Alle Gefäße, die weniger als ein 3/4 voll sind, sollten mit Elektrophoresepuffer aufgestockt werden. Nicht die Wells überfüllen! Der Rand des Puffers sollte nicht höher als das Plastik sein, um einem Verschleppen vorzubeugen, falls der Deckel verrutscht. Puffer aus den sauberen Wells (Spur 5) in die benutzten Wells (Spur 1) füllen. Sicherstellen, dass die beladenen Wells (Well mit Agarose) mit Elektrophoresepuffer befüllt sind. Der Puffer sollte 'gerade so' über der Agarose sein und komplett flach erscheinen Die Pippin Prep langsam schließen und schauen, dass beim Schließen des Geräts kein Puffer den Deckel berührt. Den Kontinuitätstest durchführen. Wenn die Sensoren leicht ausgetrocknet sind, schlägt der Kontinuitätstest üblicherweise fehl. Falls der Kontinuitätstest fehl schlägt, den Test noch einmal durchführen. Ist der Kontinuitätstest beendet, das Pippin langsam öffnen. Sicherstellen, dass durch den Deckel der Pippin Prep keine Flüssigkeit durch die Kassette durchgezogen wurde. Kurz die Marker K Loading Solution vortexen und runterzentrifugieren. 10 μL Marker K Loading Solution zu den ~30 μL Library hinzugeben. Kurzes vortexen der Library und runterzentrifugieren 40 μL Puffer aus dem Proben-Well, das benutzt wird, entfernen. ~40 μL der Library, beladen mit dem with Marker K, zu dem Proben-Well, das verwendet wird, hinzugeben. Die verwendete Spur mit den Initialien des Technikers und dem Datum markieren. Das Pippin Prep schließen und den "Start"-Knopf anklicken. Sicherstellen, dass die entsprechende Spur angeschaltet wurde. Die Probe sollte 45 Minuten laufen. Nachdem der Lauf beendet ist, das Pippin Prep vorsichtig öffnen. Nachschauen, ob der Deckel Flüssigkeit durch die Kassette geschleppt hat. Vorsichtiges entfernen des Bandes über den Elutionsöffnungen, ohne dabei die Flüssigkeit zu streifen. Überführung des Volumens der Elutionsöffnung in ein neues 1,5 ml low-binding Gefäß Alle offenen Wells mit zwei Stück des Plattenversiegelungsbandes abdecken. Daran erinnern, ein Band auf der sauberen Seite zu lassen. Das wird es vereinfachen, das Band vom Sauberen zum Benutzten zu entfernen. Die versiegelte Kassette in seine Tasche plazieren und beiseite legen. Die gewaschene Kassette nehmen und mit MiliQ Wasser befüllen. Behutsam den Deckel der Pippin Prep schließen und gucken, um zu sehen, ob Flüssigkeit durch die gewaschene Kassette gezogen wird. Die Pippin Prep für ein paar Sekunden geschlossen lassen.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 41 │ 45



33. 34. 35. 36.



Öffnen der Pippin Prep und gucken, um zu sehen, ob Flüssigkeit durch die gewaschene Kassette gezogen wird. Die gewaschene Kassette entfernen, vom Wasser entlehren und trocknen lassen. Alles Wasser aus der Pippin Prep entfernen und behutsam schließen. Den "Shut Down" Knopf im Pippin Prep Menü wählen.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 42 │ 45





Anhang 2: Probenblatt [Header],,,,,,, IEMFileVersion,4,,,,,, Investigator Name,RHP,,,,,, Experiment Name,030315S_RHP,,,,,, Date,3/3/15,,,,,, Workflow,GenerateFASTQ,,,,,, Application,FASTQ Only,,,,,, Assay,CHOP PCR Free,,,,,, Description,030315L_RHP,,,,,, Chemistry,Default,,,,,, ,,,,,,, [Reads],,,,,,, 251,,,,,,, 251,,,,,,, ,,,,,,, [Settings],,,,,,, Adapter,AGATCGGAAGAGCACACGTC,,,,,, AdapterRead2,AGATCGGAAGAGCGTCGTGT,,,,,, ,,,,,,, [Data],,,,,,, Sample_ID,Sample_Name,Sample_Plate,Sample_Well,I7_Index_ID,index,Sample_Project,Description 001 030315S_RHP_1,001 030315S_RHP_1,030315P_RHP,A1,1,TAAGTGATC,030315S_RHP, 002 030315S_RHP_2,002 030315S_RHP_2,030315P_RHP,B1,2,GTGGTATTC,030315S_RHP, 003 030315S_RHP_3,003 030315S_RHP_3,030315P_RHP,C1,3,ATAAGTACT,030315S_RHP, 004 030315S_RHP_4,004 030315S_RHP_4,030315P_RHP,D1,4,TAGGATTCA,030315S_RHP, 005 030315S_RHP_5,005 030315S_RHP_5,030315P_RHP,E1,5,AAGTGCATA,030315S_RHP, 006 030315S_RHP_6,006 030315S_RHP_6,030315P_RHP,F1,6,TACACACAA,030315S_RHP, 007 030315S_RHP_7,007 030315S_RHP_7,030315P_RHP,G1,7,TCTCCGAGC,030315S_RHP, 008 030315S_RHP_8,008 030315S_RHP_8,030315P_RHP,H1,8,AGTAACCGC,030315S_RHP, 009 030315S_RHP_9,009 030315S_RHP_9,030315P_RHP,A2,9,AGGCAAGTT,030315S_RHP, 010 030315S_RHP_10,010 030315S_RHP_10,030315P_RHP,B2,10,CCGTACTAT,030315S_RHP, 011 030315S_RHP_11,011 030315S_RHP_11,030315P_RHP,C2,11,GCCAGGTGC,030315S_RHP, 012 030315S_RHP_12,012 030315S_RHP_12,030315P_RHP,D2,12,CAACATCAC,030315S_RHP, 013 030315S_RHP_13,013 030315S_RHP_13,030315P_RHP,E2,13,GTCAGCACC,030315S_RHP, 014 030315S_RHP_14,014 030315S_RHP_14,030315P_RHP,F2,14,CTTGGCTGT,030315S_RHP, 015 030315S_RHP_15,015 030315S_RHP_15,030315P_RHP,G2,15,GTAGTACTA,030315S_RHP, 016 030315S_RHP_16,016 030315S_RHP_16,030315P_RHP,H2,16,GCAAGTCAA,030315S_RHP, 017 030315S_RHP_17,017 030315S_RHP_17,030315P_RHP,A3,17,ATTACTACC,030315S_RHP, 018 030315S_RHP_18,018 030315S_RHP_18,030315P_RHP,B3,18,CGCTCTAAT,030315S_RHP, 019 030315S_RHP_19,019 030315S_RHP_19,030315P_RHP,C3,19,ACTTCGGTC,030315S_RHP, 020 030315S_RHP_20,020 030315S_RHP_20,030315P_RHP,D3,20,TGGTACGAC,030315S_RHP, 021 030315S_RHP_21,021 030315S_RHP_21,030315P_RHP,E3,21,TGCATAATG,030315S_RHP, 022 030315S_RHP_22,022 030315S_RHP_22,030315P_RHP,F3,22,CTGGTTGGC,030315S_RHP, 023 030315S_RHP_23,023 030315S_RHP_23,030315P_RHP,G3,23,CTCTTATTC,030315S_RHP, 024 030315S_RHP_24,024 030315S_RHP_24,030315P_RHP,H3,24,AGGACTCTC,030315S_RHP,

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 43 │ 45



Anhang

3: Amplifikat Bewertung qPCR-Geräts

mittels eines

Liste der Reagenzien

Artikel 20×TE Puffer (pH 7.5) Lambda DNA Standard (100 ng/μL) 200×QuantiFluor dsDNA Dye Steriles H2O Klasse I-Amplifikationplatte(n) Klasse II-Amplifikationplatte(n)

Lagerung 4 °C 4 °C 4 °C 20 °C bis 25 °C 4 °C 4 °C

Geliefert durch Promega Promega Promega Benutzer Schritt 2 Schritt 2



Protokoll 1. Herstellung einer seriellen Verdünnung mittels 1,5 mL Mikrozentrifugenröhrchen und dem QuantiFluor Lambda DNA Standard (100 ng/μL). Befolge die nachstehende Verdünnungstabelle: Label auf dem Gefäß Standard 1 Standard 2 Standard 3 Standard 4 Standard 5 Standard 6 Standard 7, Blank

Input DNA Lambda DNA Standard 1 Standard 2 Standard 3 Standard 4 Standard 5 Blank

Volumen DNA (μL) 7,5 μL 250 μL 250 μL 250 μL 250 μL 250 μL 0 μL

Volumen 1x TE (μL) 492,5 μL 250 μL 250 μL 250 μL 250 μL 250 μL 250 μL

End Konz. (ng/μL) 1,5 ng/μL 0,75 ng/μL 0,38 ng/μL 0,19 ng/μL 0,09 ng/μL 0,05 ng/μL 0 ng/μL



1. Vorbereitung der Amplifikat-Verdünnungsplatte mit Hilfe einer 96-Well Deep-Well Platte (1 mL pro Well Fassungsvermögen) Zugabe von 498 μL 1×TE Buffer pro Well entsprechend der Amplifikate-Platte. Zugabe von 2 μL DNA aus der Amplifikate-Platte in das entsprechende Well auf der Amplifikat-Verdünnungsplatte. Die Pipettenspitze sollte immer gründlich gespült werden. Die Platte versiegeln und gut vortexen. Platte für 10 Sekunden zentrifugieren 2. 1×QuantiFluor Dye working solution nach folgendem Rezept vorbereiten 0,5 μL QuantiFluor Dye (200X) + 99,5 μL 1×TE Puffer. Ausreichend 1×QuantiFluor Dye Working Solution vorbereiten, so dass jede Probe (gesamte Proben auf der Amplifikate-Platte) und der Standard (6 Standards und ein Blank Lauf in doppelter Ausfertigung) ein Aliquot von 50 μL bekommt. 3. In eine neue 96-Well-Platte, die kompatibel zum jeweiligen qPCR Gerät ist, Aliquote von 50 μL 1×QuantiFluor Dye Working Solution in die verwendeten Well pipettieren.

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 44 │ 45





4. Unter Verwendung der vorangegangenen Standards-Vorbereitung, 50 μL von jedem Standard im Doppel in einzelne Wells der 96-Well-Bewertungsplatte auftragen (insgesamt 14 Wells) Mixen durch Pipettieren. 5. Dann 50 μL der verdünnten Amplifikate der entsprechenden Wells in die AmplifikateVerdünnungsplatten in die jeweiligen Wells der 96-Well-Bewertungsplatten auftragen. Mixen durch Pipettieren. 6. Eine Bewertungsplatte nach der anderen in das qPCR-Gerät stellen und folgendes Programm laufen lassen:



Anzahl der Zyklen 1

2



Temperatur 25 °C 25 °C 25 °C

Zeit 10 Sekunden 15 Sekunden 30 Sekunden (Datenerwerb)

7. Die Konzentration der DNA in der Amplifikate-Bewertungsplatte, unter Verwendung der unverarbeiteten RFU-Daten, erzeugt vom qPCR Gerät, berechnen. 8. Die DNA in den Amplifikate-Platten mit sterilem H2O verdünnen, so dass die Endkonzentration der DNA ca. 67 ng/μL betrifft.





Im Fall einer DNA-Konzentration von 150 ng/μL oder mehr: Zugabe von 25 μL of H2O



Im Fall einer DNA-Konzentration zwischen 100-150 ng/μL: Zugabe von 10 μL H2O



Ist die DNA-Konzentration weniger als 100 ng/μL: Zugabe von 0 μL H2O

Omixon Holotype HLA-24/7 Konfiguration A1 & CE Anleitung zur Benutzung von V8. Zur Benutzung von In vitro-Diagnostik. Copyright©2015, Omixon Biocomputing Ltd. Confidential & Proprietary

Seite 45 │ 45